circad | circRNAs associated with diseases

hsa_circ_0008719
Gene	AKT2	Organism	Human
Genome Locus	chr19:40761064-40771258:-	Build	hg19
Disease	Pancreatic Ductal Adenocarcinoma	ICD-10	Malignant neoplasm of Pancreatic duct (C25.3)
DBLink	Link to database	PMID	27997903
Experimental Method
Sample Type	Tissues	Comparison	Pancreatic Ductal Adenocarcinoma (PDAC) samples and corresponding normal tissues were prospectively collected from 20 patients
Method for Estimation	Quantitative PCR and Microarrays	PCR Details	Detailed Experimental Procedure
Primers (Experimented)	Forward CCCCCTTAAACAACTTCTCCG Reverse GCGTGGTACGCTGTCACCTA	Statistics	Fold Change : Downregulated pvalue : p<0.05
Citation
Li, H, Hao, X, Wang, H, Liu, Z, He, Y, Pu, M, Zhang, H, Yu, H, Duan, J, Qu, S (2016). Circular RNA Expression Profile of Pancreatic Ductal Adenocarcinoma Revealed by Microarray. Cell. Physiol. Biochem., 40, 6:1334-1344.